Georgia Tech Research Horizons

Bioinformatics: The Art & Science of Decoding Life

Georgia researchers are finding genes and breaking barriers with bioinformatics.

By Jane M. Sanders

CGCGTGAACTGCTTCCTGCAGGCTGGCCATGGCGCTTCACGTTCCCAAGGCTCCGGGCTTTGC CCAGATGCTCAAGGAGGGAGCGAAACACTTTTCAGGATTAGAAGAGGCTGTGTATAGAAACAT ACAAGCTTGCAAGGAGCTTGCCCAAACCACTCGTACAGCATATGGACCAAAAGGAATGAACAA AATGGTTATCAACCACTTGGAGAAGTTGTTTGTGACAAACGATGCAGCAACTATTTTAAGAGAAC TAGAAGTACAGCATCCTGCTGCAAAAATGATTGTAATGGCTTCTCATATGCAAGAGCAAGAAGTT GGAGATGGCACAAACTTTGTTCTGGTATTTGCTGGAGCTCT
photo by Gary Meek

The Georgia Research Alliance, headed by Mike Cassidy, plans to devote a significant portion of its proposed budget for fiscal year 2002 to a bioinformatics initiative. The organization's ultimate goal is the growth of high-tech industry in Georgia. (300-dpi JPEG version - 489k)

No, this gibberish is not a misprint. This string of letters A, C, G and T – which represent the four chemical bases or building blocks of life – is a small portion of a human DNA sequence. Within this entire sequence of 1,821 characters are genes, some of which are chemically activated, and thus "turned on" or expressed. Expressed genes make RNA, which in turn makes proteins that are the building blocks of cells and control their function.
photo by Stanley Leary

Bioinformatics is the future of life sciences, says Georgia Tech Prof. Mark Borodovsky. He created GeneMark, one of the most used and accurate software programs for finding genes in genomic DNA sequences.

Finding the genes and proteins they code for within this relatively small sequence is a large task in itself. But magnify the problem to three billion sequenced letters – the result of the Human Genome Project, a draft of which was completed last year. How can scientists possibly manage this amount of data – and more that is on the way – and then mine it for valuable genetic discoveries to aid in diagnosing, treating and even preventing disease, perhaps based on an individual's genetic makeup?

In a word, the answer is bioinformatics. Its definition varies, depending on the scope of one's interpretation. To bioinformatics pioneer Mark Borodovsky, a professor of biology and mathematics at the Georgia Institute of Technology, the term refers to the interdisciplinary science that combines mathematical, statistical and computer science methods to interpret biological data and answer biological questions.

"Bioinformatics is the future of life sciences," says Borodovsky, who created GeneMark, one of the most used and most accurate software programs for finding genes in genomic DNA sequences. "A wealth of new genomic data conceals endless gems of biological knowledge and, with bioinformatics, researchers can generate new ideas and test new hypotheses much faster."

The definition of bioinformatics has broadened in the past several years from analysis of gene sequence data to the process of integrating many kinds of biological data to find new meaning, says Jim Prestegard, a professor of biochemistry and molecular biology at the University of Georgia.

"Now we're realizing that to have a full understanding of how biological systems work and how they relate to disease, you need more than analysis of genomic data," Prestegard says. "It is still necessary to deal with enormous amounts of data, so bioinformatics is the same today in that sense.... But now we need to integrate sequence information with information on gene expression and the character of protein products. Ultimately, we need to integrate our observations with physiological function of complete organisms and someday with clinical records."


Whatever the definition of bioinformatics, most scientists agree the field holds great promise not only for new discoveries, but also for increasing the speed at which those findings are delivered. "The interesting thing now is this paradigm shift in biology," says Scott Hemby, an assistant professor of pharmacology and psychiatry at Emory University. "We've gone from analyzing one gene at a time to tens of thousands in one fell swoop. This a leap of science."
photo by Gary Meek

Scott Hemby, director of the DNA Microarry Facility at Emory University, is combining the power of bioinformatics with microarray technology to find genes that are critical in disease formation. Microarray technology allows researchers to analyze 10,000 to 20,000 genes simultaneously. (300-dpi JPEG version - 417k)

This paradigm shift will make it possible to see major results from today's basic scientific research in one-half to one-third of the time, Hemby adds.

This shift has not gone unnoticed by economic developers and entrepreneurs, including those in Georgia. With the development of high-tech industry as its ultimate goal, the Georgia Research Alliance (GRA) plans to devote a significant portion of its proposed budget for fiscal year 2002 to a bioinformatics initiative. Over the next two years, the money would fund 10 to 12 new "GRA Eminent Scholars," equipment and facilities at six Georgia research universities – Georgia Tech, the University of Georgia, Emory University, the Medical College of Georgia, Georgia State University and Clark Atlanta University.

Already, the GRA has funded 12 Eminent Scholars and their labs to do research associated with bioinformatics and life sciences. Plans call for the creation of a Center for Bioinformatics Research, which will support life science studies in all GRA institutions. Meanwhile, Georgia Tech is preparing students for careers in bioinformatics with a master's degree program that began in 1999. Funded by the Alfred Sloan Foundation, it was the first such program in the nation.

"We're populating our universities with the best and brightest scientists who are doing cutting-edge work that will lead to the best scientific discoveries at our universities," says Mike Cassidy, president of the GRA. "In turn, that will become a magnet that will attract more companies in genomics and bioinformatics to the state."

To plan its bioinformatics initiative, the GRA staff talked at length with its current Eminent Scholars. "We want to know what drives them, what their passion is about, what their science is and what they think that science can be applied to," Cassidy explains. "That's how we're going to build a whole new industry in the state of Georgia. We don't have a lot of traditional biotechnology industry in the state, but we're convinced that this is going to be very big. Unless we do something very aggressive and very bold, we'll be left behind. So we're moving rapidly to make sure we're making the right investments in the state."

Their efforts seem to be paying off already with the development of biotechnology business incubators, the rise in start-up companies – some of which academic researchers have founded – and the recent moves of two established companies to Georgia. EmTech Bioscience is a commercial research and development center focussed on the life sciences. EmTech, a partnership between the GRA and Georgia Tech's Advanced Technology Development Center, is operated by both Emory and Georgia Tech. NuTec Science, an established bioinformatics and supercomputing company, moved to Georgia last summer and became the anchor corporation at EmTech.

Meanwhile, the Center for Applied Genetic Technologies (AGTEC) at the University of Georgia in Athens is an incubator for agriculture-related biotech companies, including start-ups ProLinia and AviGenics. Also, Merial Ltd., a major manufacturer of animal vaccines, recently relocated its headquarters to Atlanta. Its plans call for the construction of a pilot vaccine development plant in Athens. Both animal and human vaccines will be manufactured there, bringing new high-tech jobs to Georgia.

"Georgia's initiative in bioinformatics has a huge amount of potential," says Gary Schuster, dean of the College of Sciences at Georgia Tech. "It's interesting that five years ago, almost nobody knew what bioinformatics was. Now we are charting its course, and that can be difficult. But almost everyone agrees that bioinformatics is at the core of all the promises the 'Biological Revolution' has to offer. It is being able to manage huge data sets, being able to mine huge data sets and determine what's important and what's not, whether it's for drug discovery or fundamental knowledge."


Many researchers – from molecular biologists to bioengineers to animal scientists – are fascinated by the prospects of bioinformatics and dependent upon its analysis of biological data. Few are developing the tools of bioinformatics. Among those is Borodovsky with the creation of GeneMark software and the latest version GeneMark.hmm (for the Hidden Markov Model upon which its algorithms are based). The former has been used to completely decipher the genomes of dozens of bacterial species, including the infamous E. coli.
photo by Gary Meek

Robert Nerem, director of Georgia Tech's Petit Institute for Bioengineering and Bioscience, believes the next generation of bioinformatics tools, available in five to 10 years, will be based more so than current ones on predictive mathematical models. (300-dpi JPEG version - 435k)

Both versions can analyze DNA sequences from higher organisms, including humans, but the latter more accurately predicts the boundaries between introns (non-coding regions) and exons (regions coding for proteins). In higher organisms, a gene starts in a sequence and then can be interrupted by an intron. Then the gene proceeds again with several more interruptions.

A Belgian researcher's study published in the November 1999 issue of the journal Bioinformatics found that GeneMark.hmm was the most accurate among several other state-of-the-art programs in predicting genes in plants.

GeneMark is licensed by about 150 companies and institutions worldwide, including Harvard, Stanford and Columbia universities, the National Center for Biotechnology Information, the Max Planck Institute and the European Bioinformatics Institute. Others use GeneMark via the software's Web site servers at Georgia Tech and in the United Kingdom. The U.S. server analyzes about 3,000 sequences a month.

Borodovsky's research is funded by the National Institutes of Health through 2003. In the next several years, he plans to improve and diversify GeneMark, transforming it into a whole family of academically based software programs that are regularly updated and widely available. Borodovsky founded Gene Probe, a small spin-off company that provides technical support and distribution for GeneMark programs.

The next generation of bioinformatics tools, available in five to 10 years, will be based more so than current ones on predictive mathematical models, says Robert Nerem, director of both Georgia Tech's Petit Institute for Bioengineering and Bioscience (IBB) and the Georgia Tech/Emory Center for the Engineering of Living Tissues. Better tissue substitutes will depend upon these models, which should predict function of these materials both in the laboratory and the body.

IBB researchers are developing such models, as are a host of academic and corporate researchers across the nation. At Georgia Tech, involved faculty members are: Gang Bao, Robert Guldberg and Joe LeDoux in the Georgia Tech/Emory University Department of Biomedical Engineering; Ray Vito and Cheng Zhu in the School of Mechanical Engineering; Athanassios Sambanis in the School of Chemical Engineering; and, of course, Borodovsky.


Meanwhile, researchers at GRA institutions are using the current power of bioinformatics to make valuable leaps forward in basic science, biotechnology and medicine that could revolutionize diagnosis and treatment of disease. Much of this work is collaborative, particularly in biomedical engineering, because of degree program and research partnerships between Georgia Tech and Emory.
photo by Gary Meek

The forces that control the structure of DNA – and ultimately chemical activation of some genes – are a hotly debated scientific question. Georgia Tech Professor Loren Williams is addressing these questions in his structural biology laboratory. (300-dpi JPEG version - 495k)

"Tech researchers need Emory scientists, who understand what the applications should be," says Don Giddens, chairman of the joint Department of Biomedical Engineering and a GRA Eminent Scholar. "Conversely, Emory researchers need the people who understand the technology and who can do the modeling."

Moving the department's research beyond bioinformatics is Giddens' goal. "Engineering is a field that implements things," Giddens says. "So that's our connection. We want to plug into bioinformatics and be a part of it, but we are stressing how to move that information into the medical and clinical arenas."

Plans call for a GRA Eminent Scholar in the joint department; this researcher would focus on Giddens' vision of "bioinformatics and beyond." Giddens also cites two important ongoing projects. They are: (1) a basic scientific study by Gang Bao of the physical forces that change or disrupt DNA; (2) a technology under development by Joe LeDoux for delivering genes for gene therapy.

Researchers in the Georgia Tech School of Electrical and Computer Engineering also depend upon bioinformatics. Professor William Hunt is developing microelectronic biosensor devices for molecular detection of target molecules. Knowing the target molecules around which to design the biosensor is the product of biomedical research and bioinformatics.

One application of Hunt's research could be for rapid protein screening. For cancer screening, a biosensor would know the proteins to search for in a urine sample. The result might be an early detection of a specific cancer.

Hunt's current devices can detect as little as a 3-hertz shift in a 250-megahertz resonant frequency of a surface acoustic wave biosensor. The shift occurs when molecules bind to the surface of the device. That sensitivity level is equivalent to about 10 parts per billion, but Hunt does not know if it will be sufficient for detecting proteins for early cancer screening. To that end, he is evaluating the acoustic design of his devices, as well as the design of the chips on which the microelectronic system resides.

While he awaits more information on the appropriate target molecules, Hunt is focusing on the development of increasingly more sensitive devices. "What I am working on has to be part of a collaborative effort," Hunt says. "I can build sensitive devices, but unless I know what target molecule to look for, I am just an electrical engineer building neat stuff."

Just down the hall from Hunt, Assistant Professor Bruno Frazier has begun a five-year collaborative research project funded by the National Institutes of Health. He and his collaborators from Princeton University, the University of Virginia and Agilent Technologies are miniaturizing sample preparation for biological and biochemical analysis. Specifically, Frazier is developing ways to prepare blood for genetic analysis. The technology will allow scientists to take a blood sample and extract the important components, such as DNA, from it.

"This project is one component in a total analysis system that includes sample prep, an analysis component and a detection/bioinformatics component," Frazier explains. ".... Ultimately, this system could be used for minimally invasive diagnosis or treatment of certain types of cancers or other diseases."

Frazier's work occurs at the interface of electrical systems, such as an integrated circuit, with biological components, such as cells. Specifically, he approaches the sample prep system's task of cell sorting and selection through electrophysiology, the study of electrical properties of cells. In the case of blood, Frazier uses electrical components, such as a conductor, to measure its passive electrical properties (e.g., resistance and capacitance). He has found that certain types of cells have certain electrophysiological signatures. The micro system device can use those signatures to sort red and white blood cells and to sort and detect certain types of cancer cells.

Researchers will use the tools of bioinformatics to analyze data gathered by Frazier's micro system. Then they can visualize the data with a contour plot, for example. This process is what gives the data meaning, Frazier says. In the project's final phase, researchers plan to build a portable biochemical analysis device that will incorporate Frazier's system.


Researchers at Emory University are combining the power of bioinformatics with DNA microarray technology to find genes that are critical in disease formation. DNA microarray technology allows researchers to analyze 10,000 to 20,000 genes simultaneously. At the GRA-funded DNA Microarray Facility at Emory, researchers put about 10,000 spots of DNA on a microscope slide. Then through a process called reverse transcription, researchers label RNA and hybridize it with DNA on the slide.

"It's like putting a puzzle together," explains Hemby, director of the facility. "All the pieces are there. You just have to put them back together in the right places."

Scientists then bombard the slide with light under a microscope that is like a laser scanner. What is emitted is either green or red. Using the tools of bioinformatics, researchers then analyze the intensities of emitted light to determine the abundance of genes and possibly whether the genes are mutated, either of which could be indicators for disease. Many diseases have genetic components; these include certain types of cancers and psychiatric disorders, such as schizophrenia, autism and drug abuse. Hemby is studying psychiatric disorders.

The evaluation and results of microarray experiments are what Hemby and his colleagues call a gene expression profile. They have patented a technique for creating the profiles for schizophrenia and drug abuse.

"When we learn more about diseases, we will be able to diagnose based on what genes are expressed," says Mike Kuhar, a GRA Eminent Scholar and chief of the Neuroscience Division at Emory's Yerkes Primate Research Center. "So the genetic profile provides us with a bull's eye to shoot at with medications. What medication may be right for me might not be right for you."

For example, Hemby is collaborating with Emory Professor and GRA Eminent Scholar Rafi Ahmed to identify a subset of genes responsible for HIV patients' tolerance to medications called highly active antiretroviral therapies (HAART). After the researchers identify the subset, Hemby's lab will use a smaller candidate gene chip to expedite this approach of Ahmed's research. Eventually, it may be possible for patients to use a self-test device to see if they are developing drug tolerance.

This is an example of the individualization of medicine, Hemby says. Other Emory researchers are working to tailor medicines to best treat certain types of cancer. Hemby plans to use microarray and bioinformatics technologies to create a database of genetic profiles for a variety of psychiatric diseases, all of which scientists believe will yield a specific expression profile.

In other research at Emory, Kuhar and his colleagues used bioinformatics technology to study a new neurotransmitter in the brain; it is called the CART peptide for Cocaine and Amphetamine Regulated Transcript. CART helps control food intake and is partly responsible for the feeling of satiety. The finding may eventually lead to new medications for obesity.

"Imagine the power of bioinformatics," Kuhar says. ".... Without a single experiment in the laboratory, just by sitting at a computer, the uncovered information at the terminal drives the direction of subsequent research. Bioinformatics told us that CART was a neuropeptide, so our research went in a different direction than it would have if we found that CART was another kind of protein."


Animal scientists have also discovered the power of bioinformatics, as well as microarray analysis. At the University of Georgia, Associate Professor Steve Stice is cloning livestock to make more copies of the best animals. Eventually, he hopes to make genetic changes in the clones to produce animals that are more disease resistant, use fewer resources and are more environmentally friendly (e.g., manipulating the genes that control animal odors).
photo by Rick O'Quinn

At the University of Georgia, Associate Professor Steve Stice is cloning livestock to make more copies of the best animals. He says bioinformatics helps his research team determine what genetic information is useful.

"Scientists are finding more genes all the time, so there are many possibilities for what we can do," says Stice, also a GRA Eminent Scholar. "I like to say the pigs are piggybacking on the mouse and human genome projects. We don't know as much about the genes of pigs and cattle, but we are learning a lot more."

In fact, the Human Genome Project has revealed that there is an 80 to 90 percent similarity in genetic makeup between humans and farm animals. The difference occurs in how those genes are expressed, and in what and how many proteins are produced, Stice explains.

"That's where bioinformatics comes in," he says. "It's not just the ability to know the genes, but to know how they interact in the body. That's the really important part."

Stice is collaborating with Hemby at the DNA Microarray Facility to determine why some cloned cattle embryos develop better than others. Now, only one in 50 cloned embryos eventually produce offspring. Microarray technology will allow Stice to compare gene expression in embryos that succeed in development and those that don't. Then he can devise a genetic technique for dealing with that difference, he says.

"This work is still in a very early stage," Stice says. "We are still learning how to use this technology with cattle. But bioinformatics is so important. It will help us determine what genetic information is useful."


In the vitally important arena of basic scientific research, bioinformatics is also playing a role. At Georgia Tech, Loren Williams in the School of Chemistry and Biochemistry is focusing on structural biology. Genes are expressed in both the sequence of DNA bases and the three-dimensional shape of DNA. The forces that control the structure of DNA are a hotly debated scientific question – one that Williams is addressing. Scientists do not yet understand how a linear meter of DNA gets folded to fit into a tiny cell nucleus, or how a cell recognizes which part of the DNA to unfold and read.

Williams uses X-ray diffraction to help answer these questions. In X-ray diffraction, the researcher takes a sample protein or piece of DNA or RNA, purifies it and then crystallizes it – essentially dehydrating the sample in a chemical "soup." At that point, he exposes the sample to an X-ray beam and collects the diffraction pattern. Some of this work is done on the synchrotron beam lines at Argonne and Brookhaven national laboratories, which provide especially brilliant X-ray sources. Cameras equipped with light-sensitive integrated circuits called charge-coupled devices collect the X-ray diffraction patterns from the synchrotron, and high-speed computers process the data. It takes about three months for scientists to determine the three-dimensional structure of a macromolecule by X-ray diffraction. Within a couple years, the process will take only three days and eventually only three hours or so, Williams predicts.
photo by Gary Meek

Georgia Tech Professor William Hunt is developing microelectronic biosensor devices for molecular detection of target molecules. One application of Hunt's research could be in rapid protein screening for early cancer detection. (300-dpi JPEG version - 990k)

The slow part of Williams' research is interpreting the three-dimensional structures, trying to understand molecular interactions. For example, he is interested in why a DNA macromolecule takes on a particular shape. "The structural information is starting to come in to us too fast," Williams says. "Now we have a bioinformatics problem. Bioinformatics gives us a way of asking the whole database these questions."

Learning why macromolecules take particular shapes is potentially useful in application-driven research such as drug design. But the information is also critical for understanding fundamental phenomena in DNA bending and protein folding. The applications of such basic research are never obvious, but neither were the applications of the Internet when it was first built, Williams says. Quoting from the movie "Field of Dreams," Williams hastens to add, "If you build it, they will come."

"Basic research leads to unexpected things," Williams says. "Bioinformatics has given scientists huge databases to which they can ask questions. We are only limited by our imaginations."

At the University of Georgia, structural biologists use both X-ray diffraction, or crystallography, and nuclear magnetic resonance (NMR) technology to study proteins. They are collaborating with researchers from Georgia State University, the University of Alabama at Birmingham and Huntsville, and a Huntsville company called Research Genetics to form one of seven recently funded NIH pilot centers for structural genomics. Eminent Scholar and Professor B.C. Wang is the lead investigator, and GRA Eminent Scholar Prestegard is one of seven other co-investigators. The goal of the center is to provide structural information on proteins in a volume useful to bioinformaticists, Prestegard says.

"We're working with a very new paradigm in science," he explains. ".... Historically, structural biologists have worked from a recognized biological function back to fundamental information, such as the three-dimensional structure of proteins and gene sequences. Now, we are almost turning that approach upside down. The philosophy of structural genomics is to start from the genes.... Even if we don't know the function of the protein, we can crystallize it and use X-ray crystallography or NMR to get structural information on it."

X-ray crystallography delivers about 80 percent of structural protein information; NMR provides the remainder. Prestegard uses NMR, the same technology used in biomedical imaging, but on an atomic scale. Typically, determination of a complete protein structure (i.e., knowing where every atom is placed) using NMR would take three to four weeks of data acquisition and then a lot more time for data analysis. Instead of pursuing this course, Prestegard's research team developed an efficient technique for studying only the "backbone fold" of a protein. They believe the backbone fold's restrictions on placement of the various chemical side chains will help identify a protein's function. The research is helped, in part, by the highly sophisticated laboratory equipment purchased with funds from the GRA.

"We believe this technique will be a very useful stepping stone that, along with the tools of bioinformatics, will allow us to make functional predictions from a more fundamental level," Prestegard says. "This technique is increasing the rate of data acquisition from three to four weeks to just three to four days.

".... There's a lot of work to be done," Prestegard says. "It's not just getting the basic structure. We need to bring together information from a lot of sources like gene transcription profiles and mass spectrometry data on expressed proteins. In my view, that's where modern bioinformatics is going. We're not only focusing on analysis. The real payoff is in integrating the information. That's the frontier."


At the GRA, Cassidy wants Georgia on the bioinformatics frontier and fast.

"There will be a rapid explosion in bioinformatics in the next five years," Cassidy says, "particularly in the tools needed to decipher and interpret genomic data. Estimates indicate that bioinformatics will become a $49 billion industry in the next four to six years."
photo by Rick O'Quinn

University of Georgia Professor Jim Prestegard and his colleagues have developed an efficient technique for studying only the "backbone fold" of a protein. They are using the technique and the tools of bioinformatics to help identify protein function.

Long-term economic development prospects related to bioinformatics are in therapeutics and pharmaceuticals. Researchers in this arena are expected to increase their drug discovery targets from about 400 to 4,000 over the next 20 years as bioinformatics matures and individualized medicine becomes commonplace, Cassidy says. The pharmaceutical industry is expected to increase from $300 billion a year to $300 trillion during that timeframe.

Georgia's academic researchers are excited by the prospects, too, but they caution that many factors will affect the state's ultimate success in bioinformatics-related economic development.

"There is a long way between knowledge accumulation and a medical treatment revolution," Borodovsky says of the promises touted by the Human Genome Project. "There has been a fundamental, revolutionary change in biological science. The Human Genome Project has been a groundbreaking thing. Scientists are changing how they do experiments, how they collect information before doing experiments, how they interpret results. Everything is different from the way it was 10 years ago.

"But there is still a process of hard scientific work to go inch by inch with generating and testing ideas, and making sense out of data," Borodovsky says. "It's a process of trial and error. It's not just a jump into a gold mine."

Nerem believes Georgia could become one of several hubs for bioinformatics-related industry. He is particularly encouraged by the relocation of NuTec Science to Atlanta. More companies and more Eminent Scholars, particularly in molecular and cell biology, are needed to build a solid infrastructure, he says.

Others agree on the point of bringing more GRA Eminent Scholars to Georgia. "We need more investment," Prestegard says. "But all of this takes quite a while. Georgia is doing the right things. It has a tremendous advantage in the GRA. Not many states have such a mechanism."

Williams hopes to see a "perfect synergy" between the long-term basic scientific research of academia and the short-term applied research of industry. "We can push the envelope of science if companies and academia will share their resources," he says.

Giddens cites the complementary capabilities of the six GRA universities. There are those developing the tools of bioinformatics, those gathering the data, those analyzing and interpreting the data, and those who will integrate the data with new tools of bioinformatics.

"We don't yet know the potential of bioinformatics," Williams says. "The databases are getting bigger. We have new kinds of information. We are getting better algorithms. It's inconceivable what we can learn with these new tools."

For more information, contact Robert Nerem, Petit Institute of Bioengineering and Bioscience, Georgia Institute of Technology, Atlanta, GA 30332-0405. (Telephone: 404-894-2768) (E-mail: robert.nerem@ibb.gatech.edu); or Gary Schuster, College of Sciences, Georgia Institute of Technology, Atlanta, GA 30332-0365. (Telephone: 404-894-3300) (E-mail: gary.schuster@cos.gatech.edu); or Mike Cassidy, Georgia Research Alliance, 50 Hurt Plaza, Suite 980, Atlanta, GA 30303 (Telephone: 404-332-9770) (E-mail: mcassidy@gra.org)


Contents    Research Horizons    GT Research News    GTRI    Georgia Tech

Send questions and comments regarding these pages to Webmaster@gtri.gatech.edu
Last updated: Feb. 16, 2001